 |
 |
|
|
| Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
| circKIF4A | |||
| Gene | KIF4A | Organism | Human |
| Genome Locus | Build | hg19 | |
| Disease | Triple-Negative Breast Cancer (TNBC) | ICD-10 | Malignant neoplasm of breast (C50) |
| DBLink | PMID | 30744636 | |
| Experimental Method | |||
| Sample Type | Tissue and cell lines | Comparison | human mammary epithelial cell line (MCF10A), NTNBC cell lines (MCF-7, T47D, BT474 and SKBR3) and TNBC cell lines (MDA-MB-453, MDA-MB-468, MDA-MB-231, BT549 and HCC38) |
| Method for Estimation | Quantitative PCR | PCR Details | |
| Primers (Experimented) | Forward GAGGTACCCTGCCTGGATCT ReverseTGGAATCTCTGTAGGGCACA | Statistics | Fold Change : Upregulated pvalue : <0.05 |
| Citation | |||
| Tang, H, Huang, X, Wang, J, Yang, L, Kong, Y, Gao, G, Zhang, L, Chen, ZS, Xie, X (2019). circKIF4A acts as a prognostic factor and mediator to regulate the progression of triple-negative breast cancer. Mol. Cancer, 18, 1:23. | |||